Quick Order

Text Size:AAA

Human CST2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CST2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001322.2
RefSeq ORF Size:426bp
cDNA Description:Full length Clone DNA of Homo sapiens cystatin SA with N terminal His tag.
Gene Synonym:CST2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Cystatin-SA, also known as Cystatin-2, Cystatin-S5 and CST2, is a secreted protein which belongs to the cystatin family. Cystatin-2 / CST2 is expressed in submandibular and sublingual saliva but not in parotid saliva (at protein level). It is also expressed in submandibular gland and parotid gland. The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions, where they appear to provide protective functions. The CST1, CST2, CST4, and CST5 are expressed in differential, tissue-specific patterns. Expression of CST2 and CST5 is restricted to the submandibular and parotid glands, while CST1 and CST4 are expressed in these tissues and in the lacrimal gland.

Size / Price
Catalog: HG11567-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"