After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MAPKAPK3 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAPKAPK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_004635.3
RefSeq ORF Size:1149bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase-activated protein kinase 3 with C terminal HA tag.
Gene Synonym:3PK, MAPKAP3, MAPKAPK3
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

The MAPKAP kinases are a group of MAP kinase substrates which are themselves kinases. In response to activation, the MAP kinases phosphorylate downstream components on a consensus Pro-X-Ser/Thr-Pro motif. Several kinases that contain this motif have been identifed and serve as substrates for the ERK and p38 MAP kinases. Mitogen-activated protein (MAP) kinase-activated protein kinase 3, also known as MAPKAPK-3 and 3pK, is a member of the Ser/Thr protein kinase family. It is Widely expressed in human tissues, with a higher expression level observed in heart and skeletal muscle. No expression in brain. MAPKAPK-3 is unique since it was shown to be activated by three members of the MAPK family, namely extracellular-signal-regulated kinase (ERK), p38, and Jun-N-terminal kinase (JNK). It is highly activated both by mitogens and by stress-inducing agents or proinflammatory cytokines, and translocates to the cytoplasm from nucleus. MAPKAPK-3 is exclusively activated via the classical MAPK cascade, while stress-induced activation of MAPKAPK-3 is mainly mediated by p38, however the mechanism defining the specificity remains unknown.

References
  • McLaughlin, M.M. et al., 1996, J. Biol. Chem. 271:8488-8492.
  • Tanoue, T. et al., 2001, EMBO J. 20: 466-479.
  • Neufeld, B. et al., 2000, J. Biol. Chem. 275: 20239-20242.
  • Zakowski,V. et al., 2004, Exp Cell Res. 299: 101-109.
  • Voncken, J. W. et al., 2005, J. Biol. Chem. 280: 5178-5187.
  • Size / Price
    Catalog: HG10683-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"