Quick Order

Human MAP2K2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAP2K2cDNA Clone Product Information
cDNA Size:1203
cDNA Description:ORF Clone of Homo sapiens mitogen-activated protein kinase kinase 2 DNA.
Gene Synonym:MEK2, MKK2, MAPKK2, PRKMK2, FLJ26075, MAP2K2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Dual specificity mitogen-activated protein kinase kinase 2, also known as MAP kinase kinase 2, MAPKK2, ERK activator kinase 2, MAPK / ERK kinase 2, MEK2 and MAP2K2, is a member of the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K2 / MEK2 contains one protein kinase domain. MEK1 and MEK2 (also known as MAP2K1 and MAP2K2, respectively) are evolutionarily conserved, dual-specificity kinases that mediate Erk1 and Erk2 activation during adhesion and growth factor signaling. MAP2K1 / MEK1 is a crucial modulator of Mek and Erk signaling and have potential implications for the role of MEK1 and MEK2 in tumorigenesis. MAP2K2 / MEK2 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. It also activates the ERK1 and ERK2 MAP kinases. Defects in MAP2K2 are a cause of cardiofaciocutaneous syndrome (CFC syndrome) which is characterized by a distinctive facial appearance, heart defects and mental retardation. Heart defects include pulmonic stenosis, atrial septal defects and hypertrophic cardiomyopathy.

  • MacDonald,T.J. et al., 2001, Nat Genet. 29 (2):143-52.
  • Mittal R., et al., 2006, Proc. Natl. Acad. Sci. USA. 103:18574-9.
  • Narumi,Y. et al., 2007, Am J Med Genet A. 143A (8):799-807.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Catalanotti,F. et al., 2009, Nat Struct Mol Biol. 16 (3):294-303.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items