Quick Order

Text Size:AAA

Human ARG1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ARG1 cDNA Clone Product Information
NCBI RefSeq:NM_000045.2
RefSeq ORF Size:969bp
cDNA Description:Full length Clone DNA of Homo sapiens arginase, liver with N terminal His tag.
Gene Synonym:ARG1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Arginase is the focal enzyme of the urea cycle hydrolysing L-arginine to urea and L-ornithine. Emerging studies have identified arginase in the vasculature and have implicated this enzyme in the regulation of nitric oxide (NO) synthesis and the development of vascular disease. Arginase also redirects the metabolism of L-arginine to L-ornithine and the formation of polyamines and L-proline, which are essential for smooth muscle cell growth and collagen synthesis. Arginase is encoded by two recently discovered genes (Arginase I and Arginase II). In most mammals, Arginase 1 (ARG1) also known as Arginase, liver, which functions in the urea cycle, and is located primarily in the cytoplasm of the liver. The second isozyme, Arginase II, has been implicated in the regulation of the arginine/ornithine concentrations in the cell. It is located in mitochondria of several tissues in the body, with most abundance in the kidney and prostate. It may be found at lower levels in macrophages, lactating mammary glands, and brain.

References
  • Durante W, et al. (2007) Arginase: a critical regulator of nitric oxide synthesis and vascular function. Clin Exp Pharmacol Physiol. 34(9): 906-11.
  • Waddington SN. (2002) Arginase in glomerulonephritis. Kidney Int. 61(3): 876-81.
  • Morris SM. (2002). Regulation of enzymes of the urea cycle and arginine metabolism. Annual review of nutrition. 22 (1): 87-105.
  • Size / Price
    Catalog: HG11558-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"