Quick Order

Influenza A H1N1 (A/Brisbane/59/2007) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
cDNA Size:1698
cDNA Description:ORF Clone of Influenza A H1N1 (A/Brisbane/59/2007) Hemagglutinin DNA. This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
Gene Synonym:Hemagglutinin, HA
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Size / Price
List Price: $395.00  (Save $80.00)
Price:$315.00      [How to order]
Availability5 business days
  • Influenza A H1N1 (Brisbane/59/2007,2008-2009) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
Recently Viewed Items