Quick Order

Text Size:AAA

Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTPN12cDNA Clone Product Information
cDNA Size:2388
cDNA Description:ORF Clone of Homo sapiens protein tyrosine phosphatase, non-receptor type 12 DNA.
Gene Synonym:PTPG1, PTP-PEST, PTPN12
Restriction Site:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11556-ACG$345
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11556-ACR$345
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11556-ANG$345
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11556-ANR$345
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11556-CF$315
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11556-CH$315
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11556-CM$315
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11556-CY$315
Human PTPN12 Gene cDNA Clone (full-length ORF Clone)HG11556-M$195
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11556-M-F$445
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11556-M-N$445
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11556-NF$315
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11556-NH$315
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11556-NM$315
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11556-NY$315
Human PTPN12 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11556-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

PTPN12 is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. PTPN12 contains a C-terminal PEST motif, which serves as a protein–protein interaction domain, and may be related to protein intracellular half-life. PTPN12 was found to bind and dephosphorylate the product of oncogene c-ABL, thus may play a role in oncogenesis. PTPN12 was shown to interact with, and dephosphorylate, various of cytoskeleton and cell adhesion molecules, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin, which suggested its regulatory roles in controlling cell shape and mobilit.

  • Garton AJ. et al., 1997, Oncogene. 15 (8): 877-85.
  • Lin Yi. et al., 2003, Am J Physiol Heart Circ. 285 (2): H710-21.
  • Takekawa M. et al., 1994, FEBS Lett. 339 (3): 222-8.