Quick Order

Text Size:AAA

GFP ORF mammalian expression plasmid (Codon Optimized), His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
 GFP cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:717bp
cDNA Description:Full length Clone DNA of green fluorescent protein with His tag.
Gene Synonym:GFP
Species:
Vector:pCMV/hygro-His
Plasmid:pCMV-GFP-10his
Restriction Site:KpnI + XhoI (5.5kb + 0.75kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAX31732.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The green fluorescent protein (GFP) is a protein that exhibit bright green fluorescence when exposed to blue light. GFPSparkTM is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSparkTM is mainly intended for applications where fast appearance of bright fluorescence is crucial. Its amazing ability to generate a highly visible, efficiently emitting internal fluorophore is both intrinsically fascinating and tremendously valuable. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

References
  • Evdokimov et al. (2006). EMBO Rep, 7 (10):1006–1012 / pmid: 16936637.
  • Haas et al. (1996). Curr Biol, 6 (3): 315–324 / pmid: 8805248.
  • Kremers et al. (2006). Biochemistry, 45 (21): 6570–6580 / pmid: 16716067.
  • Li et al. (1998). J Biol Chem, 273 (52): 34970–34975 /pmid: 9857028.
  • Reid and Flynn (1997). Biochemistry, 36 (22): 6786–6791 / pmid: 9184161.
  • Shagin et al. (2004). Curr Biol, 21 (5): 841–850 / pmid: 14963095.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"