Quick Order

Human ADH7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADH7cDNA Clone Product Information
cDNA Size:1161
cDNA Description:ORF Clone of Homo sapiens alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide DNA.
Gene Synonym:ADH4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Calcium/calmodulin-dependent protein kinase type I I subunit alpha, also known as CaM kinase II subunit alpha, CAMKA, and CAMK2A, is a member of the protein kinase superfamily, CAMK Ser/Thr protein kinase family, and CaMK subfamily. CAMK2A contains one protein kinase domain. CAMK2 is a prominent kinase in the central nervous system that may function in long-term potentiation and neurotransmitter release. As a member of the NMDAR signaling complex in excitatory synapses, it may regulate NMDAR-dependent potentiation of the AMPAR and synaptic plasticity. CAMK2 is composed of four different chains: alpha, beta, gamma, and delta. The different isoforms assemble into homo- or heteromultimeric holoenzymes composed of 8 to 12 subunits. CAMK2 interacts with BAALC, MPDZ, SYN1, CAMK2N2 and SYNGAP1.

  • Nagase T., et al., 1999, DNA Res. 6: 63-70.
  • Schmutz J., et al., 2004, Nature. 431: 268-274.
  • Krapivinsky G., et al., 2004, Neuron 43:563-574. 
  • Ignotz,GG. et al., 2005, Biol Reprod. 73 (3): 519-26.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items