After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

GFP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GFPcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:717
cDNA Description:ORF Clone of green fluorescent protein DNA.
Gene Synonym:GFP
Species:
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAX31732.1.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

The green fluorescent protein (GFP) is a protein that exhibit bright green fluorescence when exposed to blue light. GFPSparkTM is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSparkTM is mainly intended for applications where fast appearance of bright fluorescence is crucial. Its amazing ability to generate a highly visible, efficiently emitting internal fluorophore is both intrinsically fascinating and tremendously valuable. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

References
  • Evdokimov et al. (2006). EMBO Rep, 7 (10):1006–1012 / pmid: 16936637.
  • Haas et al. (1996). Curr Biol, 6 (3): 315–324 / pmid: 8805248.
  • Kremers et al. (2006). Biochemistry, 45 (21): 6570–6580 / pmid: 16716067.
  • Li et al. (1998). J Biol Chem, 273 (52): 34970–34975 /pmid: 9857028.
  • Reid and Flynn (1997). Biochemistry, 36 (22): 6786–6791 / pmid: 9184161.
  • Shagin et al. (2004). Curr Biol, 21 (5): 841–850 / pmid: 14963095.
  • Size / Price
    Catalog:AG13105-G-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • GFP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"