Quick Order

Human NCAM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NCAM1cDNA Clone Product Information
cDNA Size:2286
cDNA Description:ORF Clone of Homo sapiens neural cell adhesion molecule 1 DNA.
Gene Synonym:CD56, NCAM, MSK39, NCAM1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Glial cell line-Derived Neurotrophic Factor (GDNF) Related Products
Product nameProduct name

NCAM1, also known as CD56, is a neural adhesion protein (NCAM) which belongs to the immunoglobulin superfamily. NCAM is involved in neural development and in plasticity in the adult brain. UCHL1 is a novel interaction partner of both NCAM isoforms that regulates their ubiquitination and intracellular trafficking. NCAM1 is a cell adhesion molecule involved in neuron-neuron adhesion, neurite fasciculation, outgrowth of neurites, etc. NCAM1 has also been shown to be involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance.

  • Reyes AA. et al., 1991, Mol Cell Biol. 11 (3): 1654-61.
  • Suzuki M. et al., 2003, J Biol Chem. 278 (49): 49459-68.
  • Becker C G. et al., 1996, J Neurosci Res. 45 (2): 143-52.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items