Quick Order

Human VSIG2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
VSIG2cDNA Clone Product Information
cDNA Size:984
cDNA Description:ORF Clone of Homo sapiens V-set and immunoglobulin domain containing 2 DNA.
Gene Synonym:CTH, CTXL, 2210413P10Rik, VSIG2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

V-set and immunoglobulin domain-containing protein 2, also known as cortical thymocyte-like protein, CT-like protein and VSIG2, is a single-pass type I membrane protein which contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. VSIG2 is highly expressed in stomach, colon, prostate, trachea and thyroid glands and weakly in bladder and lung. V-set domains are Ig-like domains resembling the antibody variable domain. V-set domains are found in diverse protein families, including immunoglobulin light and heavy chains; in several T-cell receptors such as CD2 (Cluster of Differentiation 2), CD4, CD80, and CD86; in myelin membrane adhesion molecules; in junction adhesion molecules (JAM); in tyrosine-protein kinase receptors; and in the programmed cell death protein 1 (PD1).

  • Satow Y, et al.,1986, J. Mol. Biol. 190(4): 593-604. 
  • Kariuki,S.N. et al., 2010, Arthritis Res Ther. 12 (4):R151.