Quick Order

Human FCRL1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FCRL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_052938.4
RefSeq ORF Size:1290bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) receptor 7 with N terminal His tag.
Gene Synonym:FCRH1, IFGP1, IRTA5, DKFZp667O1421, FCRL1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Fc receptor-like protein 1, also known as FcR-like protein 1, Fc receptor homolog 1, IFGP family protein 1, Immune receptor translocation-associated protein 5 and FCRL1, is a single-pass type I  membrane protein which contains three Ig-like C2-type (immunoglobulin-like) domains. It is a cell-surface membrane protein belonging to FCRL family and is preferentially expressed on B cells. FCRL1 is primarily expressed in secondary lymphoid tissues by mature subsets of B cells. It is detected in spleen, lymph node, heart, skeletal muscle, kidney, liver and placenta. FCRL1 is specifically expressed by mature B lineage cells with higher expression in naive versus memory B cells (at protein level). Human Fc receptor-like molecules (FCRL1, FCRL2, FCRL3, FCRL4, FCRL5) have tyrosine-based immunoregulatory potential and are expressed by B-lineage subpopulations. FCRL1 may function as an activating coreceptor in B cells. It may also function in B cells activation and differentiation.

References
  • Du X. et al., 2008, Blood. 111 (1): 338-43.
  • Kazemi T. et al., 2008, Int J Cancer. 123 (9): 2113-9.
  • Baranov K. et al., 2008, J Immunol Methods. 332 (1-2): 73-81.
  • Size / Price
    Catalog: HG11536-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"