Quick Order

Human ADAMTSL1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ADAMTSL1 cDNA Clone Product Information
Gene_bank_ref_id:BC030262
RefSeq ORF Size:1320bp
cDNA Description:Full length Clone DNA of Homo sapiens ADAMTS-like 1 with C terminal His tag.
Gene Synonym:C9orf94, PUNCTIN, ADAMTSR1, ADAMTSL-1, ADAMTSL1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

ADAMTSL1 is a secreted molecule resembling members of the ADAMTS protein family of matrix metalloproteinases. Both ADAMTS proteins and ADAM protein family contain a disintegrin and a metalloprotease domain. Metallospondins is collective term for members of ADAMTS protein family. ADAMTS proteins lack the EGF-like domain found normally in members of the ADAM protein family. They also do not possess the canonical disintegrin sequence found in the ADAM protein family. It contains the domains found in members of the ADAMTS protein family with the exception of the pro-metalloprotease and the disintegrin-like domain typical of this family. ADAMTSL1 gene is expressed in adult skeletal muscle. ADAMTSL1 may play an important role in the extracellular matrix as it is deposited in the cell substratum in a punctate fashion and is excluded from focal contacts.

References
  • Hirohata S, et al. (2002) Punctin, a novel ADAMTS-like molecule, ADAMTSL-1, in extracellular matrix. J Biol Chem. 277 (14): 12182-9.
  • Wang LW, et al. (2007) O-fucosylation of thrombospondin type 1 repeats in ADAMTS-like-1/punctin-1 regulates secretion: implications for the ADAMTS superfamily. J Biol Chem. 282 (23): 17024-31.
  • Hall NG, et al. (2004) ADAMTSL-3/punctin-2, a novel glycoprotein in extracellular matrix related to the ADAMTS family of metalloproteases. Matrix Biol. 22 (6): 501-10.
  • Size / Price
    Catalog: HG13550-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"