Quick Order

Text Size:AAA

Human LILRA3 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LILRA3 cDNA Clone Product Information
Gene_bank_ref_id:BC028208
RefSeq ORF Size:1320bp
cDNA Description:Full length Clone DNA of Homo sapiens leukocyte immunoglobulin-like receptor, subfamily with C terminal His tag.
Gene Synonym:e3, HM31, HM43, ILT6, LIR4, CD85E, LIR-4, LILRA3
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

ILT6, also known as LILRA3, belongs to the ILT family. In human, the ILT gene family includes up to 11 members. The extracellular portion of all members includes at least two and usually four immuno-globulin domains. ILT-2 through 5 are all inhibitory members having variable numbers of cytoplasmic ITIM domains. ILT6 lacks a transmembrane domain. The function of ILT6 is currently unknown. however it is highly homologous to other LILR genes, and can bind human leukocyte antigen (HLA) class I. Therefore, if secreted, the ILT6 might impair interactions of membrane-bound LILRs (such as LILRB1, an inhibitory receptor expressed on effector and memory CD8 T cells) with their HLA ligands, thus modulating immune reactions and influencing susceptibility to disease.

References
  • Wi?niewski A, et al. (2004) Distribution of LILRA3 (ILT6 / LILRA3/LIR4) deletion in psoriatic patients and healthy controls. Hum Immunol. 64(4):458-61.
  • Norman PJ, et al. (2003) DNA sequence variation and molecular genotyping of natural killer leukocyte immunoglobulin-like receptor, LILRA3. Immunogenetics. 55(3):165-71.
  • Cella M, et al. (1997) A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J Exp Med. 185(10): 1743-51.
  • Size / Price
    Catalog: HG13549-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"