Quick Order

Text Size:AAA

Human DPEP1 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human DPEP1 cDNA Clone Product Information
NCBI RefSeq:BC017023
RefSeq ORF Size:1236bp
cDNA Description:Full length Clone DNA of Homo sapiens dipeptidase 1 (renal) with C terminal His tag.
Gene Synonym:MDP, RDP, MBD1, DPEP1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Dehydropeptidase-I, also known as DPEP1, is a kidney membrane enzyme. Its expression in normal colonic mucosa is very low, but it is highly expressed in colorectal adenoma and cancer specimens and is negatively correlated with parameters of pathological aggressiveness and poor prognosis. The overexpression of DPEP1 suppressed tumor cells invasiveness and increased sensitivity to chemotherapeutic agent Gemcitabine. Growth factor EGF treatment decreased DPEP1 expression. Dehydropeptidase-I may be a candidate target in PDAC for designing improved treatments. It uses zinc as a cofactor and acts as a disulfide-linked homodimer.

References
  • Toiyama Y. et al., 2011, J Gastroenterol. 46 (2): 153-63.
  • Zhang G. et al., 2012, PLoS One. 7 (2): e31507.
  • Okamoto T. et al., 2011, Mod Pathol. 24 (2): 267-76.
  • Size / Price
    Catalog: HG13543-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"