After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ART3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ART3cDNA Clone Product Information
cDNA Size:1170
cDNA Description:ORF Clone of Homo sapiens ADP-ribosyltransferase 3 DNA.
Gene Synonym:ART3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

ART3 is an arginine-specific ADP-ribosyltransferase which belongs to the Arg-specific ADP-ribosyltransferase family. ART3 catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. It is expressed specifically in testis. ART3 pseudogene is located on chromosome 11. ART3 was identified as a susceptibility gene for non-obstructive azoospermia (NOA). It is a novel therapeutic target in the treatment of NOA.

  • Lévy I, et al. (1996) Human testis specifically expresses a homologue of the rodent T lymphocytes RT6 mRNA. FEBS Lett. 382(3):276-80.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200 (1-2):149-56.
  • Balducci E, et al. (1999) Selective expression of RT6 superfamily in human bronchial epithelial cells. Am J Respir. 21(3):337-46.