Quick Order

Human SerpinB2 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPINB2 cDNA Clone Product Information
Gene_bank_ref_id:NM_002575.1
RefSeq ORF Size:1248bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 2 with C terminal HA tag.
Gene Synonym:PAI, PAI2, PAI-2, PLANH2, HsT1201
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
SerpinB2, also known as Plasminogen activator inhibitor 2, Placental plasminogen activator inhibitor, Monocyte Arg-serpin, Urokinase inhibitor and PAI2, is a cytoplasm protein which belongs to the serpin family and Ov-serpin subfamily. SerpinB2 is a major product of activated monocytes and macrophages and is substantially induced during most inflammatory processes. Distinct from its widely described extracellular role as an inhibitor of urokinase plasminogen activator. SerpinB2 has been shown to have an intracellular role as a retinoblastoma protein (Rb)-binding protein that inhibits Rb degradation. SerpinB2 is widely described as an inhibitor of urokinase plasminogen activator. SerpinB2 inhibits urokinase-type plasminogen activator. The monocyte derived SerpinB2 is distinct from the endothelial cell-derived PAI-1. SerpinB2 is a potentially important inducible host factor that significantly promotes HIV-1 replication.

References
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Schroder,WA. et al., 2010, J Immunol. 184 (5): 2663-70.
  • Size / Price
    Catalog: HG10641-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"