Quick Order

Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTPN9cDNA Clone Product Information
Gene_bank_ref_id:NM_002833.2
cDNA Size:1782
cDNA Description:ORF Clone of Homo sapiens protein tyrosine phosphatase, non-receptor type 9 DNA.
Gene Synonym:MEG2, PTPMEG2, PTPN9
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11517-ACG$345
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11517-ACR$345
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11517-ANG$345
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11517-ANR$345
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11517-CF$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11517-CH$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11517-CM$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11517-CY$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone)HG11517-M$115
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11517-M-F$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11517-M-N$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11517-NF$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11517-NH$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11517-NM$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11517-NY$315
Human PTPN9 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11517-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"