After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human F13B Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
F13BcDNA Clone Product Information
cDNA Size:1986
cDNA Description:ORF Clone of Homo sapiens coagulation factor XIII, B polypeptide DNA.
Gene Synonym:FXIIIB, F13B
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Coagulation factor XIII B chain, also known as Fibrin-stabilizing factor B subunit, Protein-glutamine gamma-glutamyltransferase B chain, Transglutaminase B chain and F13B, is a secreted protein which contains 10 Sushi ( CCP / SCR ) domains. Coagulation factor XIII is the last zymogen to become activated in the blood coagulation cascade. Plasma factor XIII is a heterotetramer composed of 2 A subunits and 2 B subunits. The A subunits have catalytic function, and the B subunits do not have enzymatic activity and may serve as a plasma carrier molecules. Platelet factor XIII is composed of just 2 A subunits, which are identical to those of plasma origin. The B chain of factor XIII is not catalytically active, but is thought to stabilize the A subunits and regulate the rate of transglutaminase formation by thrombin. Factor XIII acts as a transglutaminase to catalyze the formation of gamma-glutamyl-epsilon-lysine crosslinking between fibrin molecules, thus stabilizing the fibrin clot. Factor XIII deficiency is classified into two categories: type I deficiency, characterized by the lack of both the A and B subunits; and type II deficiency, characterized by the lack of the A subunit alone. These defects can result in a lifelong bleeding tendency, defective wound healing, and habitual abortion. Defects in F13B are the cause of factor XIII subunit B deficiency ( FA13BD ) which is an autosomal recessive disorder characterized by a life-long bleeding tendency, impaired wound healing and spontaneous abortion in affected women.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks