After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PRKAR1A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRKAR1AcDNA Clone Product Information
Gene_bank_ref_id:BC036285
cDNA Size:1146
cDNA Description:ORF Clone of Homo sapiens protein kinase, cAMP-dependent, regulatory, type I, alpha DNA.
Gene Synonym:CAR, CNC, CNC1, PKR1, TSE1, ADOHR, PPNAD1, PRKAR1, ACRDYS1, PRKAR1A
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human PRKAR1A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

PRKAR1A, also known as PRKAR1 and PKR1, is one of the regulatory subunits of cAMP-dependent protein kinase A (PKA). PKA can be activated by cAMP. cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating PKA, which transduces the signal throughphosphorylation of different target proteins. The inactive holoenzyme of PKA is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits of PKA have been identified in humans. PRKAR1A was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids Three alternatively spliced transcript variants encoding the same protein have been observed.

References
  • Huang L J. et al., 1997, Proc Natl Acad Sci. 94 (21): 11184-9.
  • Herberg F W. et al., 2000, J Mol Biol. 298 (2): 329-39.
  • Scambler P. et al., 1987, Am J Hum Genet. 41 (5): 925-32.
  • Size / Price
    Catalog:HG14416-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"