After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CLEC4D Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC4DcDNA Clone Product Information
Gene_bank_ref_id:NM_080387.4
cDNA Size:648
cDNA Description:ORF Clone of Homo sapiens C-type lectin domain family 4, member D DNA.
Gene Synonym:MCL, MPCL, CLEC6, CLEC-6, CLECSF8, MGC40078, CLEC4D
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

C-type lectin (CLEC) family is a type of carbohydrate-binding protein domain named lectin. C-type lectins are the most diverse and prevalent lectin family in immunity with its requirement for calcium for binding. Proteins including a C-type lectin domain have diverse range of functions including cell-cell adhesion, immune response to pathogens and apoptosis. There are at least 14 types of C-type lectins: typeⅠto typeⅩⅣ. CLEC4D(CLECSF8) is a typeⅡ membrane glycoprotein belonging to the C-type lectin family, with restricted expression in the monocyte/macrophage lineage. It plays important roles in the function of macrophages.

References
  • Johnson KD, et al. (2007) Friend of GATA-1-independent Transcriptional Repression: A Novel Mode of GATA-1 Function. Blood. 109 (12): 5230-3.
  • Arce I, et al. (2004) The human C-type lectin CLECSF8 is a novel monocyte/macrophage endocytic receptor. Eur J Immunol. 34 (1): 210-20.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36 (8): 2159-69.
  • Size / Price
    Catalog:HG11485-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"