Quick Order

Human DCX ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DCX cDNA Clone Product Information
Gene_bank_ref_id:BC027925
RefSeq ORF Size:1083bp
cDNA Description:Full length Clone DNA of Homo sapiens doublecortin with C terminal His tag.
Gene Synonym:DC, DBCN, LISX, SCLH, XLIS, DCX
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

DCX (doublecortin, N-GST chimera)contains 2 doublecortin domains and belongs to the doublecortin family. It is highly expressed in neuronal cells of fetal brain, but not expressed in other fetal tissues. In the adult, it is highly expressed in the brain frontal lobe, but very low expression in other regions of brain, and not detected in heart, placenta, lung, liver, skeletal muscles, kidney and pancreas. DCX is a microtubule-associated protein required for initial steps of neuronal dispersion and cortex lamination during cerebral cortex development. It may act by competing with the putative neuronal protein kinase DCAMKL1 in binding to a target protein. DCX may in that way participate in a signaling pathway that is crucial for neuronal interaction before and during migration, possibly as part of a calcium ion-dependent signal transduction pathway. It may be part with LIS-1 of a overlapping, but distinct, signaling pathways that promote neuronal migration. Defects in DCX are the cause of lissencephaly X-linked type 1 and subcortical band heterotopia X-linked.

References
  • Des Portes V, et al. (1998) A novel CNS gene required for neuronal migration and involved in X-linked subcortical laminar heterotopia and lissencephaly syndrome. Cell. 92:51-61.
  • Gleeson J G, et al. (998) Doublecortin, a brain-specific gene mutated in human X-linked lissencephaly and double cortex syndrome, encodes a putative signaling protein. Cell. 92:63-72.
  • Ross M T, et al. (2005) The DNA sequence of the human X chromosome. Nature. 434:325-37.
  • Size / Price
    Catalog: HG13498-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"