Quick Order

Human CMA1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CMA1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001836.2
RefSeq ORF Size:744bp
cDNA Description:Full length Clone DNA of Homo sapiens chymase 1, mast cell with N terminal His tag.
Gene Synonym:CYH, MCT1, chymase, MGC119890, MGC119891, CMA1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Takai S, et al. (2003) Effect of chymase inhibitor on vascular proliferation. Jpn J Pharmacol. 90 (3): 223-7.
  • Caughey GH, et al. (1993) The human mast cell chymase gene (CMA1): mapping to the cathepsin G/granzyme gene cluster and lineage-restricted expression. Genomics. 15 (3): 614-20.
  • Urata H, et al. (1991) Cloning of the gene and cDNA for human heart chymase. J Biol Chem. 266 (26): 17173-9.
  • Size / Price
    Catalog: HG11482-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"