After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
XIAPcDNA Clone Product Information
Gene_bank_ref_id:NM_001167.2
cDNA Size:1494
cDNA Description:ORF Clone of Homo sapiens X-linked inhibitor of apoptosis DNA.
Gene Synonym:API3, ILP1, MIHA, XLP2, BIRC4
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10606-ACG$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10606-ACR$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10606-ANG$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10606-ANR$325
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10606-CF$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10606-CH$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10606-CM$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10606-CY$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone)HG10606-M$95
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10606-M-N$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10606-NF$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10606-NH$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10606-NM$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10606-NY$295
Human XIAP / BIRC4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10606-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

E3 ubiquitin-protein ligase XIAP / BIRC4, also known as inhibitor of apoptosis protein 3, X-linked inhibitor of apoptosis protein, and IAP-like protein, is a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. XIAP / BIRC4 functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. XIAP / BIRC4 also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this encoding gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Thought to be the most potent apoptosis suppressor, XIAP / BIRC4, directly binds and inhibits caspases -3, -7 and -9. Survivin, which also binds to several caspases, is up-regulated in a many tumour cell types. Defects in XIAP / BIRC4 are the cause of lymphoproliferative syndrome X-linked type 2 (XLP2). XLP is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Symptoms include severe or fatal mononucleosis, acquired hypogammaglobulinemia, pancytopenia and malignant lymphoma.

References
  • Holcik M, et al. (2000) Functional Characterization of the X-Linked Inhibitor of Apoptosis (XIAP) Internal Ribosome Entry Site Element: Role of La Autoantigen in XIAP Translation. Mol Cell Biol. 20 (13): 4648-57.
  • Winsauer G, et al. (2008) XIAP regulates bi-phasic NF-kappaB induction involving physical interaction and ubiquitination of MEKK2. Cell Signal. 20 (11): 2107-12.
  • Suzuki Y, et al. (2001) X-linked inhibitor of apoptosis protein (XIAP) inhibits caspase-3 and -7 in distinct modes. J Biol Chem. 276 (29): 27058-63.
  • Size / Price
    Catalog:HG10606-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"