Quick Order

Human DCIR / CLEC4A / CLECSF6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC4AcDNA Clone Product Information
cDNA Size:714
cDNA Description:ORF Clone of Homo sapiens C-type lectin domain family 4, member A DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human DCIR / CLEC4A / CLECSF6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Related Products
Product nameProduct name

Dendritic cell immunoreceptor (DCIR), also known as C-type lectin domain family 4 member A (CLEC4A), C-type lectin superfamily member 6 (CLECSF6), is a single-pass type II C-type lectin receptor expressed mainly in dendritic cells (DCs), which is a negative regulator of DC expansion and has a crucial role in maintaining the homeostasis of the immune system. The Dectin-2 family of C-type lectins that includes Dectin-2, BDCA-2, DCIR, DCAR, Clecsf8 and Mincle. These type II receptors contain a single extracellular carbohydrate recognition domain and have diverse functions in both immunity and homeostasis. DCIR is the only member of the family which contains a cytoplasmic signalling motif and has been shown to act as an inhibitory receptor, while BDCA-2, Dectin-2, DCAR and Mincle all associate with FcRgamma chain to induce cellular activation, including phagocytosis and cytokine production. Dectin-2 and Mincle have been shown to act as pattern recognition receptors for fungi, while DCIR acts as an attachment factor for HIV. In addition to pathogen recognition, DCIR has been shown to be pivotal in preventing autoimmune disease by controlling dendritic cell proliferation. DCIR expressed on antigen presenting cells and granulocytes and acts as an inhibitory receptor via an intracellular immunoreceptor tyrosine-based inhibitory motif (ITIM). It may also be involved via its ITIM motif in the inhibition of B-cell-receptor-mediated calcium mobilization and protein tyrosine phosphorylation. Additionally, DCIR can participate in the capture of HIV-1 and promote infection in trans and in cis of autologous CD4(+) T cells from human immature monocyte-derived DCs. DCIR acts as a ligand for HIV-1 and is involved in events leading to productive virus infection.

  • Kanazawa N, et al. (2004) Signaling and immune regulatory role of the dendritic cell immunoreceptor (DCIR) family lectins: DCIR, DCAR, dectin-2 and BDCA-2. Immunobiology. 209(1-2): 179-90.
  • Fujikado N, et al. (2008) Dcir deficiency causes development of autoimmune diseases in mice due to excess expansion of dendritic cells. Nat Med. 14(2): 176-80.
  • Lambert AA, et al. (2008) The C-type lectin surface receptor DCIR acts as a new attachment factor for HIV-1 in dendritic cells and contributes to trans- and cis-infection pathways. Blood. 112(4): 1299-307.
  • Graham LM, et al. (2009) The Dectin-2 family of C-type lectins in immunity and homeostasis. Cytokine. 48(1-2): 148-55.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items