Quick Order

Human AHSP / ERAF ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AHSP cDNA Clone Product Information
Gene_bank_ref_id:BC035842
RefSeq ORF Size:309bp
cDNA Description:Full length Clone DNA of Homo sapiens erythroid associated factor with N terminal Myc tag.
Gene Synonym:EDRF, ERAF, AHSP
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

AHSP, also known as ERAF, is a conserved mammalian erythroid protein which belongs to the AHSP family. It is expressed in blood and bone marrow. AHSP facilitates the production of Hemoglobin A by stabilizing free α-globin. It rapidly binds to ferrous α with association (k'(AHSP)) and dissociation (k(AHSP)) rate constants of ≈10 μm(-1) s(-1) and 0.2 s(-1), respectively, at pH 7.4 at 22 ℃. A small slow phase was observed when AHSP binds to excess ferrous αCO. This slow phase appears to be due to cis to trans prolyl isomerization of the Asp(29)-Pro(30) peptide bond in wild-type AHSP because it was absent when αCO was mixed with P30A and P30W AHSP, which are fixed in the trans conformation. This slow phase was also absent when met(Fe(3+))-α reacted with wild-type AHSP, suggesting that met-α is capable of rapidly binding to either Pro(30) conformer. Both wild-type and Pro(30)-substituted AHSPs drive the formation of a met-α hemichrome conformation following binding to either met- or oxy(Fe(2+))-α. The dissociation rate of the met-α·AHSP complex (k(AHSP) ≈ 0.002 s(-1)) is ~100-fold slower than that for ferrous α·AHSP complexes, resulting in a much higher affinity of AHSP for met-α. Thus, in vivo, AHSP acts as a molecular chaperone by rapidly binding and stabilizing met-α hemichrome folding intermediates. The low rate of met-α dissociation also allows AHSP to have a quality control function by kinetically trapping ferric α and preventing its incorporation into less stable mixed valence Hemoglobin A tetramers. Reduction of AHSP-bound met-α allows more rapid release to β subunits to form stable fully, reduced hemoglobin dimers and tetramers.

Size / Price
Catalog: HG14391-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"