Quick Order

Human CFL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CFL2cDNA Clone Product Information
cDNA Size:501
cDNA Description:ORF Clone of Homo sapiens cofilin 2 (muscle) DNA.
Gene Synonym:NEM7, CFL2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CFL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Related Products
Product nameProduct name

Cofilin 2 (muscle), also known as CFL2, is a member of cofilin family of the actin-binding protein superfamily. Cofilin2 shows significant homology to the other two members: cofilin 1 and DSTN, through its entire sequence, and contains residues conserved among the cofilin family that are responsible for actin-binding. Cofilin 2 (CFL2) is an important regulator of striated myocyte function. Purified cofilin 2 depolymerized actin filaments in a dose- and pH-dependent manner and reduced the apparent viscosity of an actin solution, although they did not co-sediment with actin filaments at all. Cofilin2 is not expressed in vegetative cells, but is transiently induced during the aggregation stage of development, whereas cofilin 1 was predominantly expressed in vegetative cells. 

  • Aizawa H, et al. (2001) Cofilin-2, a novel type of cofilin, is expressed specifically at aggregation stage of Dictyostelium discoideum development. Genes Cells. 6 (10): 913-21.
  • Papalouka V, et al. (2009) Muscle LIM protein interacts with cofilin 2 and regulates F-actin dynamics in cardiac and skeletal muscle. Papalouka V, Mol Cell Biol. 29 (22): 6046-58.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks