Quick Order

Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTPN2cDNA Clone Product Information
cDNA Size:1248
cDNA Description:ORF Clone of Homo sapiens protein tyrosine phosphatase, non-receptor type 2, transcript variant 1 DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10570-ACG$325
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10570-ACR$325
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10570-ANG$325
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10570-ANR$325
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10570-CF$295
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10570-CH$295
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10570-CM$295
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10570-CY$295
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10570-M$95
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10570-M-F$295
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10570-M-N$295
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10570-NF$295
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10570-NH$295
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10570-NM$295
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10570-NY$295
Human PTPN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10570-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Tyrosine-protein phosphatase non-receptor type 2, also known as T-cell protein-tyrosine phosphatase, PTPN2 and PTPT, is a cytoplasm protein which belongs to the protein-tyrosine phosphatase family and Non-receptor class 1 subfamily. Members of the protein tyrosine phosphatase ( PTP ) family share a highly conserved catalytic motif, which is essential for the catalytic activity. TC-PTP / PTPN2 is a cytosolic tyrosine phosphatase that functions as a negative regulator of a variety of tyrosine kinases and other signaling proteins. The expression of TC-PTP / PTPN2 plays a role of tumor suppressor and may modulate response to treatment. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. TC-PTP / PTPN2 is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. TC-PTP / PTPN2 was identified as a negative regulator of NUP214-ABL1 kinase activity.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items