Quick Order

Text Size:AAA

Human NMNAT1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NMNAT1 cDNA Clone Product Information
Gene_bank_ref_id:NM_022787.3
RefSeq ORF Size:840bp
cDNA Description:Full length Clone DNA of Homo sapiens nicotinamide nucleotide adenylyltransferase 1 with N terminal His tag.
Gene Synonym:NMNAT, PNAT1, NMNAT1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

NMNAT, also known as NMNAT1, is a member of the Nicotinamide-nucleotide adenylyltransferases. It is widely expressed with high levels in skeletal muscle, heart, liver and kidney. NMNAT appears to have the ability to protect against axonal degeneration following mechanical or toxic insults. The coenzyme NAD and its derivatives are involved in hundreds of metabolic redox reactions and are utilized in protein ADP-ribosylation, histone deacetylation, and in some Ca(2+) signaling pathways. NMNAT enzyme is vital for NAD biosynthesis, catalyzing the condensation of nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) with the AMP moiety of ATP to form NAD or NaAD.

References
  • Sugano S. et al., 1994, Gene. 138 (1-2): 171-4.
  • Saccucci F. et al., 2001, J Biol Chem. 276 (1): 406-12.
  • Hennig K. et al., 2001, FEBS Lett. 492 (1-2): 95-100.
  • Size / Price
    Catalog: HG11448-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"