After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human B3GNT2 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human B3GNT2 cDNA Clone Product Information
NCBI RefSeq:NM_006577.5
RefSeq ORF Size:1194bp
cDNA Description:Full length Clone DNA of Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 with N terminal His tag.
Gene Synonym:B3GN-T2, B3GNT, B3GNT-2, B3GNT1, BETA3GNT, BGNT2, BGnT-2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

B3GNT2 belongs to the beta-1,3-N-acetylglucosaminyltransferase family. It is a type II transmembrane protein which prefers the substrate of lacto-N-neotetraose. Alternative splicing produced 2 isoforms of the human protein. B3GNT2 catalyzes the initiation and elongation of poly-N- acetyllactosamine chains. Enzymatic activities of some glycosyltransferases are markedly increased via complex formation with other transferases or cofactor proteins. B3GNT2 and beta3Gn-T8 can form a heterodimer in vitro and that the complex exhibits much higher enzymatic activity than either enzyme alone. It is found that up-regulation of beta3Gn-T8 in differentiated HL-60 cells may increases poly-N-acetyllactosamine chains by activating intrinsic B3GNT2.

References
  • Australo-An, et al. (2010) Genome-wide association study of ankylosing spondylitis identifies non-MHC susceptibility loci. Nat Genet. 42(2):123-7.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Seko A, et al. (2008) Activation of beta1,3-N-acetylglucosaminyltransferase-2 (beta3Gn-T2) by beta3Gn-T8. Possible involvement of beta3Gn-T8 in increasing poly-N-acetyllactosamine chains in differentiated HL-60 cells. J Biol Chem. 283(48):33094-100.
  • Size / Price
    Catalog: HG11416-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"