After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SULT2A1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SULT2A1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003167.3
RefSeq ORF Size:858bp
cDNA Description:Full length Clone DNA of Homo sapiens sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 with N terminal His tag.
Gene Synonym:HST, ST2, STD, hSTa, DHEAS, ST2A3, DHEA-ST, SULT2A1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Hydroxysteroid sulfotransferase ( SULT2A1 ) is a key enzyme in the testicular and hepatic metabolism of 5alpha-androstenone, which is a major component of the off-odor and off-flavor in pork known as boar taint. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. SULT2A1 is a sulfo-conjugating phase II enzyme expressed at very high levels in the liver and intestine, the two major first-pass metabolic tissues, and in the steroidogenic adrenal tissue. SULT2A1 acts preferentially on the hydroxysteroids dehydroepiandrosterone, testosterone/dihydrotestosterone, and pregnenolone and on cholesterol-derived amphipathic sterol bile acids.

References
  • Chatterjee, B. 2005, Methods Enzymol. 400:165-91.
  • Liu,Y. et al., 2006, Chem Res Toxicol. 19 (11):1420-5.
  • Sinclair, PA. et al., 2006, J Mol Endocrinol  36 (2):301-11.
  • Yalcin, EB. et al., 2008, Drug Metab Lett  2 (3):198-204.
  • Size / Price
    Catalog: HG11411-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"