Quick Order

Text Size:AAA

Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ECH1cDNA Clone Product Information
cDNA Size:963
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) enoyl CoA hydratase 1, peroxisomal DNA.
Gene Synonym:ECH1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90439-ACG$325
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90439-ACR$325
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90439-ANG$325
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90439-ANR$325
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90439-CF$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90439-CH$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90439-CM$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90439-CY$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone)CG90439-G$95
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90439-NF$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90439-NH$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90439-NM$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90439-NY$295
Cynomolgus monkey ECH1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90439-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

ECH1 is a member of the hydratase/isomerase superfamily. ECH1 shows high sequence similarity to enoyl-CoA hydratases of several species, particularly within a conserved domain characteristic of these proteins. ECH1 contains a C-terminal peroxisomal targeting sequence and localizes to peroxisomes. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans, 5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. ECH1 functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators.

  • Kovalyov LI, et al. (2006) Polymorphism of delta3,5-delta2,4-dienoyl-coenzyme A isomerase (the ECH1 gene product protein) in human striated muscle tissue. Biochemistry Mosc. 71(4): 448-53.
  • Olsen JV, et al. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell. 127(3):635-48.
  • FitzPatrick DR, et al. (1995) Isolation and characterization of rat and human cDNAs encoding a novel putative peroxisomal enoyl-CoA hydratase. Genomics. 27(3):457-66.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items