After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Complement component 5 / C5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
C5cDNA Clone Product Information
cDNA Size:5031
cDNA Description:ORF Clone of Homo sapiens complement component 5 DNA.
Gene Synonym:CPAMD4, C5
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human Complement component 5 / C5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name

C5a is a protein fragment released from complement component C5. This 74 amino acid peptide in humans is generated by the cleavage of C5a convertase on the C5 α-chain during the classical, alternative, and lectin pathways of complement activation. The structure of C5a includes a core region consisting of four, anti-parallel alpha-helices held together by three disulfide linkages and a structured C-terminal tail, and C5a is rapidly metabolised by carboxypeptidase B to a 73 amino acid low activity form, C5a des-Arg. C5a is an extremely potent proinflammatory mediator, as well as a potent chemotactic factor for neutrophils and other leukocytes. It causes histamine release, increases in vascular permeability, induces several cytokines production from leukocytes, enhances neutrophil-endothelial cell adhesion, and augments the humoral and cell-mediated immune response. C5a is quickly metabolised by carboxypeptidases, forming the less potent C5adesArg. Acting via a classical G protein-coupled receptor, CD88, C5a and C5adesArg exert a number of effects essential to the innate immune response, while their actions at the more recently discovered non-G protein-coupled receptor, C5L2 (or GPR77), remain unclear. The widespread expression of C5a receptors throughout the body allows C5a to elicit a broad range of effects. Thus, C5a has been found to be a significant pathogenic driver in a number of immuno-inflammatory diseases, making C5a inhibition an attractive therapeutic strategy. C5a is a strong chemoattractant and is involved in the recruitment of inflammatory cells such as neutrophils, eosinophils, monocytes, and T lymphocytes, in activation of phagocytic cells and release of granule-based enzymes and generation of oxidants, all of which may contribute to innate immune functions or tissue damage. Accordingly, the anaphylatoxin C5a is implicated in a variety of diseases such as rheumatoid arthritis, systemic lupus erythematosus, reperfusion injury, Alzheimer's disease, and sepsis.

  • Guo RF, et al.. (2005) Role of C5a in inflammatory responses. Annu Rev Immunol. 23: 821-52.
  • Guo RF, et al. (2006) C5a, a therapeutic target in sepsis. Recent Pat Antiinfect Drug Discov. 1(1): 57-65.
  • Manthey HD, et al. (2009) Complement component 5a (C5a). Int J Biochem Cell Biol. 41(11): 2114-7.
  • Size / Price
    List Price: $515.00  (Save $0.00)
    Price:$515.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items