Quick Order

Human ACOX1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACOX1 cDNA Clone Product Information
NCBI RefSeq:NM_004035.5
RefSeq ORF Size:1983bp
cDNA Description:Full length Clone DNA of Homo sapiens acyl-Coenzyme A oxidase 1, palmitoyl with N terminal His tag.
Gene Synonym:ACOX, SCOX, MGC1198, PALMCOX, ACOX1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Peroxisomal acyl-coenzyme A oxidase 1(ACOX1 or AOX) is the first enzyme of the fatty acid beta-oxidation pathway and belongs to the Acyl-CoA oxidase family. Human liver peroxisomes contain two acyl-CoA oxidases, namely, palmitoyl-CoA oxidase (ACOX1/AOX) and a branched chain acyl-CoA oxidase. The palmitoyl-CoA oxidase (ACOX1/AOX) oxidizes the CoA esters of straight chain fatty acids and prostaglandins and donates electrons directly to molecular oxygen, thereby producing H2O2. Human ACOX1/AOX is a protein of 661-amino acids, including the carboxyl-terminal sequence(Ser-Lys-Leu) known as a minimal peroxisome-targeting signal. Human ACOX1/AOX, the first and rate-limiting enzyme of the peroxisomal β-oxidation pathway, has two isoforms including ACOX1a and ACOX1b, transcribed from a single gene. The human ACOX1b isoform is more effective than the ACOX1a isoform in reversing the Acox1 null phenotype in the mouse partly because of the Substrate utilization differences.

References
  • Vluggens A, et al. (2010) Functional significance of the two ACOX1 isoforms and their crosstalks with PPAR alpha and RXR alpha. Laboratory Investigation. 90: 696-708.
  • Chu R, et al. (1995) Overexpression and characterization of the human peroxisomal acyl-CoA oxidase in insect cells. J Biol Chem. 270 (9): 4908-15.
  • Aoyama T, et al. (1994) Molecular cloning and functional expression of a human peroxisomal acyl-coenzyme A oxidase. Biochem Biophys Res Commun. 198 (3): 1113-8.
  • Size / Price
    Catalog: HG11266-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"