Quick Order

Human TPST1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TPST1 cDNA Clone Product Information
NCBI RefSeq:NM_003596.3
RefSeq ORF Size:1113bp
cDNA Description:Full length Clone DNA of Homo sapiens tyrosylprotein sulfotransferase 1 with N terminal His tag.
Gene Synonym:TPST1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Protein-tyrosine sulfotransferase 1, also known as Tyrosylprotein sulfotransferase 1 and TPST1, is a single-pass type I I membrane protein which belongs to the protein sulfotransferase family. Tyrosine O-sulfation is a common posttranslational modification of proteins in all multicellular organisms. This reaction is mediated by a Golgi enzyme activity called tyrosylprotein sulfotransferase (TPST) that catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to tyrosine residues within acidic motifs of polypeptides. Tyrosine O-sulfation has been shown to be important in protein-protein interactions in several systems. Tyrosine sulfation is mediated by one of two Golgi isoenzymes, called tyrosylprotein sulfotransferases (TPST-1 and TPST-2). A relatively small number of proteins are known to undergo tyrosine sulfation, including certain adhesion molecules, G-protein-coupled receptors, coagulation factors, serpins, extracellular matrix proteins, and hormones. TPST1 is a human tyrosylprotein sulfotransferase that uses 3'phosphoadenosine-5'phosphosulfate (PAPS) to transfer the sulfate moiety to proteins predominantly designated for secretion. TPST1 bears N-linked glycosyl residues exclusively at position Asn60 and Asn262. TPST1 and TPST2 have distinct biological roles that may reflect differences in their macromolecular substrate specificity.

References
  • Ouyang Y.-B.et al., 1998, Proc. Natl. Acad. Sci. USA. 95: 2896-901.
  • Ouyang,Y.B. et al., 2002,J Biol Chem. 277 (26):23781-7.
  • Hoffhines, A.J. et al., 2006, J Biol Chem. 281 (49):37877-87.
  • Goettsch,S. et al., 2006, J Mol Biol. 361 (3):436-49.
  • Westmuckett, A.D. et al., 2008, Gen Comp Endocrinol. 156 (1):145-53.
  • Size / Price
    Catalog: HG11258-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"