Quick Order

Human CALCB Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CALCBcDNA Clone Product Information
cDNA Size:384
cDNA Description:ORF Clone of Homo sapiens calcitonin-related polypeptide beta DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CALCB, also known as CGPR and calcitonin 2, belongs to the calcitonin family. CALCB is a calcitonin (CT) peptide which may play a role in the mediation of human inflammatory diseases. It is highly expressed in the skin, blood, and cerebrospinal fluid. CGRP immunolabeling (IL) was detected in epidermal keratinocytes at levels that were especially high and widespread in the skin of humans from locations afflicted with postherpetic neuralgia (PHN) and complex region pain syndrome type 1 (CRPS), of monkeys infected with simian immunodeficiency virus, and of rats subjected to L5/L6 spinal nerve ligation, sciatic nerve chronic constriction, and subcutaneous injection of complete Freund's adjuvant. Increased CGRP-IL was also detected in epidermal keratinocytes of transgenic mice with keratin-14 promoter driven overexpression of noggin, an antagonist to BMP-4 signaling. CGPR dilates a variety of vessels including the coronary, cerebral and systemic vasculature.

  • Lambert NA. 2008, Sci Signal. 1 (25): re5.
  • Linscheid P. et al., 2005, Endocrinology. 146 (6): 2699-708.
  • Hou Q. et al., 2011, Pain. 152 (9): 2036-51.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items