Quick Order

Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD274cDNA Clone Product Information
cDNA Size:873
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD274 molecule DNA.
Gene Synonym:CD274
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90251-ACG$325
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90251-ACR$325
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90251-CF$295
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90251-CH$295
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90251-CM$295
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90251-CY$295
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone)CG90251-G$95
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90251-NF$295
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90251-NH$295
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90251-NM$295
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90251-NY$295
Cynomolgus monkey CD274 / B7-H1 / PD-L1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90251-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor programmed death-1(PD1/PDCD1) and has been demonstrated to play a role in the regulation of immune responses and peripheral tolerance. PD-L1/B7-H1 is a member of the growing B7 family of immune molecules and this protein contains one V-like and one C-like Ig domain within the extracellular domain, and together with PD-L2, are two ligands for PD1 which belongs to the CD28/CTLA4 family expressed on activated lymphoid cells. By binding to PD1 on activated T-cells and B-cells, PD-L1 may inhibit ongoing T-cell responses by inducing apoptosis and arresting cell-cycle progression. Accordingly, it leads to growth of immunogenic tumor growth by increasing apoptosis of antigen specific T cells and may contribute to immune evasion by cancers. PD-L1 thus is regarded as promising therapeutic target for human autoimmune disease and malignant cancers.

  • Iwai Y, et al. (2002) Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade. Proc Natl Acad Sci U S A. 99(19): 12293-7.
  • Ghebeh H, et al. (2006) The B7-H1 (PD-L1) T lymphocyte-inhibitory molecule is expressed in breast cancer patients with infiltrating ductal carcinoma: correlation with important high-risk prognostic factors. Neoplasia. 8(3): 190-8.
  • Salih HR, et al. (2006) The role of leukemia-derived B7-H1 (PD-L1) in tumor-T-cell interactions in humans. Exp Hematol. 34(7): 888-94.
  • Wilcox RA, et al. (2009) B7-H1 (PD-L1, CD274) suppresses host immunity in T-cell lymphoproliferative disorders. Blood. 114(10): 2149-58.
  • Ruggiero A, et al. (2009) Crystal structure of PD-L1, a ribosome inactivating protein from Phytolacca dioica L. leaves with the property to induce DNA cleavage. Biopolymers. 91(12): 1135-42.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items