After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ECM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ECM1cDNA Clone Product Information
cDNA Size:1623
cDNA Description:ORF Clone of Homo sapiens extracellular matrix protein 1, transcript variant 1 DNA.
Gene Synonym:RP11-54A4.6, ECM1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human ECM1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name

Extracellular matrix protein 1 (ECM1) is a secreted glycoprotein and playing a pivotal role in endochondral bone formation, angiogenesis, and tumour biology. Three splice variants have been identified: ECM1a (540 aa) is most widely expressed, with highest expression in the placenta and heart; ECM1b (415 aa) is differentiation-dependent expressed and found only in tonsil and associated with suprabasal keratinocytes; ECM1c (559 aa) accounts for approximately 15% of skin ECM1. Although ECM1 is not tumor specific, is significantly elevated in many malignant epithelial tumors and is suggested as a possible trigger for angiogenesis, tumor progression and malignancies. It also has been shown to regulate endochondral bone formation, skeletal development and tissue remodeling. 

  • Oyama N, et al. (2003) Autoantibodies to extracellular matrix protein 1 in lichen sclerosus. Lancet. 362(9378): 118-23.
  • Chan I, et al. (2004) Rapid diagnosis of lipoid proteinosis using an anti-extracellular matrix protein 1 (ECM1) antibody. J Dermatol Sci. 35(2): 151-3.
  • Lupo I, et al. (2005) A novel mutation of the extracellular matrix protein 1 gene (ECM1) in a patient with lipoid proteinosis (Urbach-Wiethe disease) from Sicily. Br J Dermatol. 153(5): 1019-22.
  • Sander CS, et al. (2006) Expression of extracellular matrix protein 1 (ECM1) in human skin is decreased by age and increased upon ultraviolet exposure. Br J Dermatol. 154(2): 218-24.