After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human GranzymeH Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GZMHcDNA Clone Product Information
cDNA Size:741
cDNA Description:ORF Clone of Homo sapiens granzyme H (cathepsin G-like 2, protein h-CCPX) DNA.
Gene Synonym:CCP-X, CGL-2, CSP-C, CTLA1, CTSGL2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human GranzymeH Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name

Granzymes are key components of the immune response that play important roles in eliminating host cells infected by intracellular pathogens. Several granzymes are potent inducers of cell death. A total of eight granzymes (A-G and M) have been identified in the mouse, but only five are known in humans (A, B, H, M and granzyme 3), and granzyme H appears to be specifically human. Human granzyme H is a neutral serine protease that is expressed predominantly in the lymphokine-activated killer (LAK)/natural?killer (NK) compartment of the immune system. In adenovirus-infected cells in which granzyme B (gzmB) and downstream apoptosis pathways are inhibited, granzyme H directly cleaves the adenovirus DNA-binding protein (DBP), a viral component absolutely required for viral DNA replication. This virus demonstrated that gzmH directly induces an important decay in viral DNA replication. Interestingly, gzmH also cleaves the adenovirus 100K assembly protein, a major inhibitor of gzmB, and relieves gzmB inhibition. Granzyme H has a very high amino acid identity (>90%) with many portions of the granzyme B sequence, particularly near the amino terminus of the molecule despite performing a distinct enzymic function.