After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CDCP1 ORF mammalian expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human CDCP1 cDNA Clone Product Information
NCBI RefSeq:BC021099
RefSeq ORF Size:1032bp
cDNA Description:Full length Clone DNA of Homo sapiens CUB domain containing protein 1 with C terminal His tag.
Gene Synonym:CD318, TRASK, SIMA135, CDCP1p
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

CDCP1 contains three extracellular CUB domains. It is a putative stem cell marker that is highly expressed in some human cancer cells and in both, typical and atypical (cancerous) colons. It interacts with CDH2/N-cadherin, CDH3/P-cadherin, SDC1/syndecan-1, SDC4/syndecan-4 and the serine protease ST14/MT-SP1. It also interacts with SRC and PRKCG/protein kinase C gamma. CDCP1 is taken as a key regulator of EGF/EGFR-induced cell migration. It has been shown that signaling via EGF/EGFR induces migration of ovarian cancer Caov3 and OVCA420 cells with concomitant up-regulation of CDCP1 mRNA and protein. Consistent with a role in cell migration CDCP1 relocates from cell-cell junctions to punctate structures on filopodia after activation of EGFR. It may be involved in cell adhesion and cell matrix association. It also may play a role in the regulation of anchorage versus migration or proliferation versus differentiation via its phosphorylation. It has been taken as a novel marker for leukemia diagnosis and for immature hematopoietic stem cell subsets.

References
  • Conze T, et al.. (2003) CDCP1 is a novel marker for hematopoietic stem cells. Ann N Y Acad Sci. 996 (1): 222-6.
  • Hooper JD, et al. (2003) Subtractive immunization using highly metastatic human tumor cells identifies SIMA135/CDCP1, a 135 kDa cell surface phosphorylated glycoprotein antigen. Oncogene. 22(12): 1783-94.
  • Scherl-Mostageer M, et al. (2001) Identification of a novel gene, CDCP1, overexpressed in human colorectal cancer. Oncogene. 20(32):4402-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"