Quick Order

Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ICAM1cDNA Clone Product Information
cDNA Size:1599
cDNA Description:ORF Clone of Homo sapiens intercellular adhesion molecule 1 DNA.
Gene Synonym:BB2, CD54, P3.58
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10346-ACG$345
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10346-ACR$345
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10346-CF$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10346-CH$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10346-CM$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10346-CY$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone)HG10346-M$115
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10346-M-F$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10346-M-H$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10346-M-N$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10346-NF$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10346-NH$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10346-NM$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10346-NY$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10346-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Intercellular adhesion molecule-1 (ICAM-1, or CD54) is a 90 kDa member of the immunoglobulin (Ig) superfamily and is critical for the firm arrest and transmigration of leukocytes out of blood vessels and into tissues. ICAM-1 is constitutively present on endothelial cells, but its expression is increased by proinflammatory cytokines. The endothelial expression of ICAM-1 is increased in atherosclerotic and transplant-associated atherosclerotic tissue and in animal models of atherosclerosis. Additionally, ICAM-1 has been implicated in the progression of autoimmune diseases. ICAM-1 is a ligand for LFA-1(integrin). When activated, leukocytes bind to endothelial cells via ICAM-1/LFA-1 interaction and then transmigrate into tissues. Presence with heavy glycosylation and other structural characteristics, ICAM-1 possesses binding sites for a number of immune-associated ligands and serves as the binding site for entry of the major group of human Rhinovirus (HRV) into various cell types. ICAM-1 also becomes known for its affinity for Plasmodium falciparum-infected erythrocytes (PFIE), providing more of a role in infectious disease. Previous studies have shown that ICAM-1 is involved in inflammatory reactions and that a defect in ICAM-1 gene inhibits allergic contact hypersensitivity.

  • Xu H, et al. (2001) The role of ICAM-1 molecule in the migration of Langerhans cells in the skin and regional lymph node. Eur J Immunol. 31(10): 3085-93.
  • Terol MJ, et al. (2003) Soluble intercellular adhesion molecule-1 (s-ICAM-1/s-CD54) in diffuse large B-cell lymphoma: association with clinical characteristics and outcome. Ann Oncol. 14(3): 467-74.
  • Mendez MP, et al. (2006) Shedding of soluble ICAM-1 into the alveolar space in murine models of acute lung injury. Am J Physiol Lung Cell Mol Physiol. 290(5): L962-70.
  • Lawson C, et al. (2009) ICAM-1 signaling in endothelial cells. Pharmacol Rep. 61(1): 22-32.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks