After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rhesus SIRPG ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus SIRPG cDNA Clone Product Information
NCBI RefSeq:XM_001113667.2
RefSeq ORF Size:1164bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) signal-regulatory protein gamma with N terminal HA tag.
Gene Synonym:SIRPG
Species:Rhesus
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Signal-regulatory protein gamma (SIRPG/SIRP gamma) also known as CD172 antigen-like family member B, CD172g, and CD172g antigen, is a member of the signal-regulatory protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. SIRPG/SIRP gamma/CD172g is probable immunoglobulin-like cell surface receptor. On binding with CD47, SIRPG can mediate cell-cell adhesion. SIRPG/SIRP gamma is engagement on T-cells by CD47 on antigen-presenting cells results in enhanced antigen-specific T-cell proliferation and costimulates T-cell activation. SIRPG/SIRP gamma/CD172g is detected in liver, and at very low levels in brain, heart, lung, pancreas, kidney, placenta and skeletal muscle. Expressed on CD4+ T-cells, CD8+ T-cells, CD56-bright natural killer (NK) cells, CD20+ cells, and all activated NK cells. This cytokine is mainly present in the paracortical T-cell area of lymph nodes, with only sparse positive cells in the mantle and in the germinal center of B-cell follicles. In the thymus, SIRPG is primarily expressed in the medulla on mature T-lymphocytes that have undergone thymic selection.

References
  • Meador JA, et al. (2011) p53-independent downregulation of histone gene expression in human cell lines by high- and low-let radiation. Radiat Res. 175(6): 689-99.
  • Reddy MV, et al. (2011) Association between type 1 diabetes and GWAS SNPs in the southeast US Caucasian population. Genes Immun. 12(3): 208-12.
  • Kawasaki M, et al. (2009) Changes in the gene expression of peripheral blood mononuclear cells during the menstrual cycle of females is associated with a gender bias in the incidence of systemic lupus erythematosus. Clin Exp Rheumatol. 27(2): 260-6.
  • Size / Price
    Catalog: CG90226-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"