After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ERP27 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ERP27 cDNA Clone Product Information
Gene_bank_ref_id:BC030218
RefSeq ORF Size:822bp
cDNA Description:Full length Clone DNA of Homo sapiens endoplasmic reticulum protein 27 kDa with C terminal His tag.
Gene Synonym:PDIA8, C12orf46, ERP27
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

ERP27 contains 1 thioredoxin domain and is a noncatalytic member of the protein disulfide isomerase family. Protein disulfide isomerases (PDIs) constitute a family of structurally related enzymes which catalyze disulfide bonds formation, reduction, or isomerization of newly synthesized proteins in the lumen of the endoplasmic reticulum (ER). They act also as chaperones, and are, therefore, part of a quality-control system for the correct folding of the proteins in the same subcellular compartment. PDI has been found to have moderate effects (25-fold) on the rate of oxidative folding of proteins in vitro. Recombinant Human Protein Disulfide Isomerase is involved in disulphide-bond formation and isomerization, as well as the reduction of disulphide bonds in proteins. Recombinant PDI has been found to have moderate effects (25-fold) on the rate of oxidative folding of proteins in vitro. ERP27 is a widely expressed protein which localizes to the ER and may act as a protease, protein disulfide isomerase, thiol-disulfide oxidase or phospholipase. ERP27 doesn't contain a CXXC active site motif indicating that it is a catalytically redox-inactive member of the protein disulfide isomerase family.

References
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Alanen HI, et al. (2006) ERp27, a new non-catalytic endoplasmic reticulum-located human protein disulfide isomerase family member, interacts with ERp57. J Biol Chem. 281(44):33727-38.
  • Size / Price
    Catalog: HG13256-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"