After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human FKBP7 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FKBP7 cDNA Clone Product Information
Gene_bank_ref_id:BC009711
RefSeq ORF Size:669bp
cDNA Description:Full length Clone DNA of Homo sapiens FK506 binding protein 7 with C terminal His tag.
Gene Synonym:FKBP23, PPIase, FKBP7
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

PPIase is a member of the immunophilin protein family. It also belongs to the cyclophilin-type PPIase family, PPIL3 subfamily. PPIase contains 1 PPIase cyclophilin-type domain. Members of the immunophilin protein family play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. It has a very high substrate specificity for the four-residue peptide Ala-Ala-Pro-Phe only when the proline peptide bond is in the trans state. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium.

References
  • 1. Shor B, et al. (2008) A new pharmacologic action of CCI-779 involves FKBP12-independent inhibition of mTOR kinase activity and profound repression of global protein synthesis. Cancer Res. 68(8):2934-43.
  • 2. Talmud PJ, et al. (2009) Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip. Am J Hum Genet. 85(5):628-42.
  • 3. Deleersnijder A, et al. (2011) Comparative analysis of different peptidyl-prolyl isomerases reveals FK506-binding protein 12 as the most potent enhancer of alpha-synuclein aggregation. J Biol Chem. 286(30):26687-701.
  • Size / Price
    Catalog: HG13250-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"