Quick Order

Cynomolgus monkey THBD ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus THBD cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:1713bp
cDNA Description:Full length Clone DNA of Macaca mulatta thrombomodulin with N terminal HA tag.
Gene Synonym:THBD
Species:Cynomolgus
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Thrombomodulin, also known as THBD(CD141), is an integral membrane protein which reduces blood coagulation by converting thrombin to an anticoagulant enzyme from a procoagulant enzyme. Thrombomodulin is expressed on the surface of endothelial cells and serves as a cofactor for thrombin. It is also expressed on human mesothelial cell, monocyte and a dendritic cell subset. Thrombomodulin functions as a cofactor in the thrombin-induced activation of protein C in the anticoagulant pathway by forming a 1:1 stoichiometric complex with thrombin. Thrombomodulin also regulates C3b inactivation by factor I. Mutations in the thrombomodulin gene have also been reported to be associated with atypical hemolytic-uremic syndrome.

References
  • Dzionek A, et al. (2002) Plasmacytoid dendritic cells: from specific surface markers to specific cellular functions. Hum Immunol. 63(12):1133-48.
  • Dzionek A, et al. (2000) BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol. 165(11):6037-46.
  • Wen DZ, et al. (1987) Human thrombomodulin: complete cDNA sequence and chromosome localization of the gene. Biochemistry. 26(14):4350-7.
  • Size / Price
    Catalog: CG90216-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"