After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FOLR2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FOLR2cDNA Clone Product Information
Gene_bank_ref_id:NM_000803.4
cDNA Size:768
cDNA Description:ORF Clone of Homo sapiens folate receptor 2 (fetal) DNA.
Gene Synonym:FR-P3, FR-BETA, BETA-HFR, FBP/PL-1, FOLR2
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Folate receptor beta, also known as Folate receptor 2, FBP, and FOLR2, is a member of the folate receptor family. FOLR2 is expressed in placenta and hematopoietic cells. The expression of FOLR2 is increased in malignant tissues. Members of the Folate receptor family members (FOLRs) have a high affinity for folic acid and for several reduced folic acid derivatives. They mediate the delivery of 5-methyltetrahydrofolate to the interior of, out of within, or between cells in a process known as potocytosis. FOLR2 has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. The FOLR2 protein was originally thought to exist only in placenta, but is also detected in spleen, bone marrow, and thymus. FOLR2 is a marker for macrophages generated in the presence of M-CSF, but not GM-CSF. Its expression correlates with increased folate uptake ability. Folate conjugates of therapeutic drugs are a potential immunotherapy tool to target tumor-associated macrophages.

References
  • van Heyningen V, et al., 1995, Cytogenet Cell Genet. 69 (3-4): 127-58.
  • Sabharanjak, S. et al., 2004, Adv Drug Deliv Rev. 56 (8): 1099-109. 
  • Scapoli, L. et al., 2005, Am J Med Genet A. 132A (3): 302-4.
  • Puig-Kröger, A. et al., 2009, Cancer Res  69 (24): 9395-403.
  • Size / Price
    Catalog:HG11219-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"