Quick Order

Human GM2A ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GM2A cDNA Clone Product Information
Gene_bank_ref_id:BC009273
RefSeq ORF Size:582bp
cDNA Description:Full length Clone DNA of Homo sapiens GM2 ganglioside activator with C terminal His tag.
Gene Synonym:SAP-3, GM2-AP, GM2A
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

GM2A (GM2 ganglioside activator), is a lipid transfer protein which belongs to the ML domain family. GM2A can accommodate several single chain phospholipids and fatty acids. It also exhibits some calcium-independent phospholipase activity. GM2A binds gangliosides and stimulates ganglioside GM2 degradation. It stimulates only the breakdown of ganglioside GM2 and glycolipid GA2 by beta-hexosaminidase A. GM2A acts as a substrate specific co-factor for the lysosomal enzyme β-hexosaminidase A. β-hexosaminidase A, together with GM2 ganglioside activator, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. It extracts single GM2 molecules from membranes and presents them in soluble form to beta-hexosaminidase A for cleavage of N-acetyl-D-galactosamine and conversion to GM3. Defects in GM2A are the cause of GM2-gangliosidosis type AB (GM2GAB), also known as Tay-Sachs disease AB variant.

References
  • Wright CS, et al. (2003) Structural analysis of lipid complexes of GM2-activator protein. J Mol Biol. 331(4):951-64.
  • Size / Price
    Catalog: HG13246-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"