After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ICAM2cDNA Clone Product Information
cDNA Size:828
cDNA Description:ORF Clone of Homo sapiens intercellular adhesion molecule 2 (ICAM2), transcript variant 5 DNA.
Gene Synonym:CD102
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10332-ACG$325
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10332-ACR$325
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10332-CF$295
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10332-CH$295
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10332-CM$295
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10332-CY$295
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone)HG10332-M$95
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10332-M-F$295
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10332-M-N$295
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10332-NF$295
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10332-NH$295
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10332-NM$295
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10332-NY$295
Human ICAM-2 / CD102 transcript variant 5 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10332-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Intercellular adhesion molecule 2 (ICAM-2, CD102), belongs to the ICAM family consisting of three members identified as ligands for integrin receptors. It is a type I transmembrane glycoprotein with two Ig-like C2-type domains, and binds to the leukocyte integrins LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18). As a second ligand of leukocyte function-associated antigen-1, ICAM-2 functions as a costimulatory molecule for effector cells. ICAM-2 is mainly expressed on vascular endothelial and hematopoietic cells. Interactions of ICAM-2 and the integrin receptors mediate cell adhesion in a wide range of lymphocyte, monocyte, natural killer cell, and granulocytewith other cells, and play important roles in many adhesion-dependent immune and inflammation responses, such as T cell aggregation, NK-cell cytotoxicity and migration, lymphocyte recirculation, etc. Serum levels of ICAM-2 correlated significantly with the inflammatory and course sequences of trichinosis in mice and had a similar relation with blood eosinophilia. So, estimation of ICAM-2 serum levels may prove useful in diagnosis of trichinosis recent infections, and in monitoring the prognosis and response to treatment.

  • Weber KS, et al. (2004) Sialylation of ICAM-2 on platelets impairs adhesion of leukocytes via LFA-1 and DC-SIGN. Inflammation. 28(4): 177-88.
  • Tanaka H, et al. (2004) ICAM-2 gene therapy for peritoneal dissemination of scirrhous gastric carcinoma. Clin Cancer Res. 10(14): 4885-92.
  • Younis AI, et al. (2005) Intercellular adhesion molecule-2 (ICAM-2) in experimental trichinosis. J Egypt Soc Parasitol. 35(3): 1019-26.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items