Quick Order

Text Size:AAA

Human PRDM2 / RIZ1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRDM2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1514bp
cDNA Description:Full length Clone DNA of Homo sapiens PR domain containing 2, with ZNF domain with N terminal His tag.
Gene Synonym:RIZ, KMT8, RIZ1, RIZ2, MTB-ZF, HUMHOXY1, PRDM2
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

PR domain containing 2, with ZNF domain (PRDM2), also known as zinc finger protein RIZ, is a member of histone methyltransferase (HMT) class enzymes that methylate lysine residues of histones or proteins. HMTs contain a conserved catalytic core termed the SET domain, which shares sequence homology with an independently described sequence motif, the PR domain. PRDM2 contains 8 C2H2-type zinc fingers and a distinct SET domain, and is highly expressed in retinoblastoma cell lines and in brain tumors, as well as in a number of other cell lines and in brain, heart, skeletal muscle, liver and spleen. PRDM2 is a S-adenosyl-L-methionine-dependent histone methyltransferase that specifically methylates 'Lys-9' of histone H3, and is identified as a tumor suppressor. It is reported that intact PR( SET) sequence is required for tumor suppression functions, mutations in the PR domain caused activity reduction in human cancers. Also, S-adenosylhomocysteine or methyl donor deficiency inhibits RIZ1 and other H3 lysine 9 methylation activities. PRDM2 may also function as a DNA-binding transcription factor. It Binds to the macrophage-specific TPA-responsive element (MTE) of the HMOX1 (heme oxygenase 1) gene and act as a transcriptional activator. In addition, PRDM2 (RIZ) is able to binds to the retinoblastoma protein (RB) and also Interacts with GATA3.

References
  • Buyes, I.M. et al., 1995, Proc. Natl. Acad. Sci. U.S.A. 92: 4467-4471.
  • Muraosa, Y. et al., 1996, Eur. J. Biochem. 235: 471-479.
  • Kim, K. et al., 2003, Cancer. Res. 63: 7619-7623.
  • Shapiro, V.S. et al., 1995, Gene. 163: 329-330.
  • Briknarova, K.et al.,2008,Biochem.Biophys.Res.Commun.366:807-813.
  • Size / Price
    Catalog: HG11216-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"