Quick Order

Human GMFB Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GMFBcDNA Clone Product Information
cDNA Size:465
cDNA Description:ORF Clone of Homo sapiens glia maturation factor, beta DNA.
Gene Synonym:GMF, GMFB
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

GMFB is a nerve growth factor which belongs to the actin-binding proteins ADF family, GMF subfamily. GMFB is involved in nervous system development, angiogenesis and immune function. It is especially crucial for the nervous system. GMFB causes brain cell differentiation, stimulates neural regeneration and inhibits tumor cell proliferation. It contains 1 ADF-H domain and is phosphorylated after phorbol ester stimulation. GMFB overexpression in astrocytes results in the increase of BDNF production. GMFB expression is increased by exercise, thus BDNF is important for exercise-induction of BDNF.

  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Zaheer S, et al. (2011) Augmented expression of glia maturation factor in Alzheimer's disease. Neuroscience. 194:227-33.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items